WSMBMP
Bulletin Number 15. July 31st, 2016


Differential Expression of a Glycogen Phosphorylase Gene in Volvariella volvacea Mycelium Exposed to Low Temperature Stress

ZHAO Yan1, WANG Hong1, LI Zhengpeng1, LU Lianjing 2, CHEN Mingjie1*
(1Institute of Edible Fungi, Shanghai Academy of Agricultural Sciences, Key Laboratory of Edible Fungi Resources and Utilization (South), Ministry of Agriculture, P. R. China, National Engineering Research Center of Edible Fungi, National R&D Center for Edible Fungi Processing, Key Laboratory of Agricultural Genetics and Breeding of Shanghai, Shanghai 201403, China; 2Information Research Institute of Science and Technology, Shanghai Academy of Agricultural Sciences, Shanghai 201403, China)


 

Abstract: Relative expression of a glycogen phosphorylase gene (pyg) in mycelia of cold-sensitive (V23) and cold-tolerant (VH3) strains of Volvariella volvacea during exposure to low temperature (0 ℃) over time courses was quantified by real-time PCR using the α-tubulin gene as internal control. Pyg expression levels in strain V23 decreased after 4 h exposure and, although recovering after 6 h, still remained lower than untreated controls. Gene expression in strain VH3 decreased sharply after low temperature exposure for 2 h, reaching a minimum value after 8 h when the relative expression level was only 0.28 times that of untreated controls. Overall, although pyg expression decreased in both V23 and VH3 over prolonged exposure, the fall was less pronounced in strain V23 compared with VH3.
Key words: Volvariella volvacea; low temperature exposure; glycogen phosphorylase gene; real-time PCR
Volvariella volvacea originates from tropical and subtropical areas of China, and is both a nutritious and an important medicinal mushroom[1]. The optimum temperature for mycelial growth and fruit body development is 32 ℃[2] and, as with many tropical crops, the mushroom is susceptible to low temperature storage. The fungal mycelium undergoes autolysis and becomes non-viable when exposed to low temperatures (<15 ℃) and, if stored at 0~4 ℃, the fruit body becomes soft, undergoes liquefaction and loses its commercial value[3-4]. These characteristics restrict the post-harvest preservation and freshness during transportation of V. volvacea from farm to market, and have seriously hindered the development of the straw mushroom industry.
Glycogen, a large multi-branched polysaccharide composed of glucose residues, is a major energy storage compound that is reported to participate in fungal responses to abiotic stress[5-7]. Glycogen phosphorylase (PYG) is the rate limiting enzyme in glycogen decomposition[8], and Zhao et al.[9]have studied the correlation between the expression of pyg and low temperature stress in Artemia sinica. We have now employed real-time PCR to compare pyg expression in strains V23 and VH3 exposed to the same conditions of low temperature stress using the alpha-tubulin gene as the internal control [10-11].

1 Material and Methods
1.1 Strains
V. volvacea strains V23 and VH3 were obtained from the Culture Collection Centre of the Institute of Edible Fungi, Shanghai Academy of Agricultural Sciences. Strain VH3, which is more resistant to low temperature storage, was generated by multiple mutagenesis of strain V23 protoplasts using UV, 60Co-γ-irradiation and diethyl sulfate[12].
1.2 Reagents
Bacterial strains, kits and other reagents were obtained from suppliers as follows: Trizol, SBS Genetech Co., Ltd; PrimeScript™ RT with gDNA eraser and SYBR® Premix Ex Taq™ II (Tli RNaseH Plus), Takara Biotechnology (Dalian) Co., Ltd; Mini plasmid preparation and PCR product purification kits, Shanghai Generay Biotech Co., Ltd; Competent E. coli DH-5α cells, Tiangen Biotech (Beijing) Co., Ltd; AxyPrep™ DNA Gel Extraction Kit, Axygen Biotechnology (Hangzhou) Co., Ltd; pGEM®-T Easy Vector System I and Taq DNA Polymerase in Storage Buffer B, Promega Corporation; potato dextrose broth, Becton Dickinson (BD) Medical Equipment (Shanghai) Co., Ltd.
1.3 Pyg coding region
The genomic sequence of pyg in V. volvacea and Trametes versicolor are available on the NCBI website (http://www.ncbi.nlm.nih.gov/genome). Sequence analysis was performed using BlastX and, based on the amino acid sequence in T. versicolor, the coding nucleotide sequence of pyg in V. volvacea was obtained following the “GT-AG” rule to eliminate possible introns.
1.4 Design of primers
Primer 5.0 software was used to design primers for real-time PCR based on the V. volvacea pyg coding sequence. The coding sequence of α-tubulin gene (α-tub) was used as the internal control, and fluorescent labeled primers (Table 1) were synthesized by Shanghai Generay Biotech Co., Ltd.


Table 1  Primer pairs used for real-time PCR


Primer pairs

Primer sequence (5¢- 3¢)

α-tub-F

CCAACACTACCGCTATCTCC

α-tub-R

TTCACCTTCCTCCATACCCT

pyg-F

CCCCGAACTTAGCACTCTGA

pyg-R

GATAGCAGCCCACTTCTCCC

1.5 cDNA preparation
Total RNA was extracted from cultured fungal mycelia exposed to 0 ℃ for 2, 4, 6, 8 and 10 h with the Trizol reagent according to the manufacturer’s instructions. Non-exposed mycelia served as controls. Extracted material was dissolved in DEPC-treated water and subjected to electrophoresis on 1% agarose gels. Genomic DNA was removed with the gDNA eraser kit, total RNA was reverse transcribed into cDNAs using PrimeScript RT, and the cDNAs were stored at ﹣20 ℃ prior to use.
1.6 Amplification of target fragments and preparation of the standard plasmid
Conventional PCR amplification was used to obtain the target fragment. The standard plasmid was constructed for quantitative fluorescence PCR and sequenced by Shanghai Sangon Biological Engineering Co. Ltd[13].
1.7 Pyg gene expression
Pyg gene expression was detected using real-time fluorescence PCR. Plasmids with the target gene and internal control were used as templates after 10-fold dilution, and quantitative PCR analysis was performed using the double standard curve method[14]. cDNAs amplified from V. volvacea mycelium following exposure to 0 ℃ for different times were used as templates, and each sample was run in triplicate with ddH2O as the control. PCR reaction mixtures (20 μL) contained: 10 µL 2×SYBR® Premix Ex Taq™ II;0.8 µL each of sense and antisense primers (10 μmol/L); 0.4 µL 50×ROX Reference Dye;2 µL cDNA template,and add ddH2O to 20 µL. PCR amplification conditions were as follows: 95 ℃ for 20 s; and 40 cycles of 95 ℃ for 5 s,60 ℃ for 15 s and 72 ℃ for 15 s. The relative expression of the target gene was obtained automatically from the Rotor-Gene 3000 PCR instrument based on the standard curve.
2 Results and Analysis
2.1 RNA quality and amplification of the target gene
Total RNA quality was evaluated by agarose gel electrophoresis, which revealed clear bands corresponding to 28S, 18S and 5S ribosome RNA (Fig. 1). The integrity of the extracted RNAs was confirmed by A260/280 ratios of >1.9. Both α-tub and pyg occurred as single bands after PCR amplification (Fig. 2), and sequencing verified that both the target and designed gene sequences were identical in each case. The α-tubulin gene consisted of 114 bp: CCAACACTACCGCTATCTCCTCGGCTTGGAGTCGCCTTGATCACAAGTTCGACCTCCTCTATTCGAAGCGTGCTTTCGTGCATTGGTACGTTGGTGAGGGTATGGAGGAAGGTG.
and pyg consisted of 133 bp:CCCCGAACTTAGCACTCTGATCTCCAAGACCTTGAAGCTTGACAAGGGTGTTTGGCTCAAGGACTTGACCAAGCTCGAAGGCCTCCTCAAGTTCACAGAGGACAAGGAATTCCGGGAGAAGTGGGCTGCTATC.


M: DNA markers (100 to 2000 bp); lanes V23 and VH3: total RNA extracted from strains V23 and VH3 respectively. 28S, 18S and 5S indicate bands corresponding to 28S, 18S and 5S ribosomal RNA, respectively.
Fig. 1  Agarose gel electrophoresis of total RNA extracted from mycelia of V. volvacea, strains V23 and VH3

M: DNA markers (100 to 2000 bp); lanes 1 and 2: PCR products generated by amplification of α-tub and pyg, respectively.
Fig. 2  Agarose gel electrophoresis of PCR products generated from target and reference genes


2.2 Construction of gene amplification and standard curves
Amplification kinetics curves, prepared by plotting the intensity of fluorescence in PCR products against ten-fold serial dilutions of the pyg-containing plasmid, are shown in Fig. 3. The standard curve generated by amplification of a dilution series of the plasmid containing pyg (Fig. 4) revealed a good linear relationship between the CT value and the relative plasmid concentration. Amplification efficiency was 1.01 (Table 2). The software generated linear equation showed that R2 was greater than 0.99, which suggested that the standard curve could be used to accurately quantify unknown samples. Accordingly, the relative concentration of the samples was calculated using the CT value obtained from PCR amplification. Melting curves obtained following PCR amplification of pyg exhibited a single peak (Fig. 5), thereby indicating a high degree of specificity and confirming the reliability of the data.


Curves ‘a’, ‘b’, ‘c’, ‘d’ and ‘e’ were generated from 1.0×104, 1.0×103, 1.0×102 and 1.0×101 dilutions of, and undiluted, pyg-containing plasmid, respectively.
Fig. 3 Amplification curves of pyg from V. volvacea

Fig. 4 Standard curve of pyg gene from V. volvacea
Table 2  Regression equations for pyg and α-tub genes from V. volvacea


Gene

Regression equation

R2 Value

M

Reaction efficiency

pyg

Conc= 10^(-0.303×CT + 8.478)

0.9998

-3.29922

1.00956

α-tub

Conc= 10^(-0.272×CT + 7.313)

0.9969

-3.67032

0.87265

R2 Value (coefficient of determination) is used to assess the fit of the standard curve to the data points plotted; the closer the value to 1, the better the fit. M is the midpoint value of the transformed signal.

Fig. 5  Melting curves of pyg from V. volvacea
2.3 Relative expression of pyg
CT values were obtained by PCR analysis of the internal control and target genes in V. volvacea strains V23 and VH3 after low temperature treatment, and the relative expression of pyg was calculated. Although the relative expression of pyg decreased in both V23 and VH3 under conditions of low temperature stress, the extent of the decline was less marked in the former strain (Fig. 6). Relative pyg gene expression levels were highest in unexposed mycelium of strain V23 but decreased by 32% and 51% after low temperature treatment for 2 h and 4 h, respectively. After 6 h exposure, expression levels increased to 0.79-fold of the initial value recorded in controls, before decreasing again to 0.30-fold and 0.43-fold of control values after 8 h and 10 h exposure, respectively. In strainVH3, the decrease in the relative expression of pyg was more marked, with values falling by 60% after 2 h exposure to 4 ℃, and reaching a minimum of 0.28-fold of control values after 8 h low temperature treatment.


The relative expression amount in each sample was shown as the number on the top of each bar.
Fig. 6  Relative expression of pyg in V23 and VH3 during exposure to low temperature stress

3  Discussion
The glycolytic pathway not only generates ATP but also provides intermediates for other metabolic pathways[15]. A complete glycolytic pathway is operative in V. volvacea, and Liu et al.[16] have studied the gene (pfk) encoding the rate-limiting enzyme (phosphofructokinase) in the pathway by cloning, structural analysis and expression of pfk in different strains of the mushroom. They reported that the gene consisted of 3494 bp, encoding 818 amino acids, and found that relative gene expression levels were higher in a heterokaryotic strain (H15-21), derived by crossing two single spore isolates (PYd21 and PYd15), compared with the sum of the levels recorded in the two homokaryons. Glucose-6-phosphate, which is generated through the action of glycogen phosphorylase and phosphoglucomutase, is a precursor of the glycolytic pathway. Taken together, glycogen not only constitutes an important carbon storage compound in V. volvacea, but may also be synthesized in response to low temperature stress. Glycogen may also affect the level of efficiency at which the glycolytic pathway operates.
We now report that pyg expression decreased under conditions of low temperature stress in both the low temperaturesensitive strain V23 and in the low temperature resistant strain VH3. During the entire period that low temperature stress was applied, the decline in the rate of pyg gene expression was faster in the latter, possibly indicating that VH3 has a greater capacity for retaining glycogen. This, in turn, might provide more precursors for the glycolytic pathway or provide a form of energy storage, thereby making VH3 better able to respond to low temperature stress. Further studies are required to clarify the role of glycogen phosphorylase in the low temperature stress response of V. volvacea, and pave the way for genetic manipulation aimed at overcoming the obstacle of low temperature autolysis in this mushroom.
                                                                                                                             
References
[1] YANG XM. China edible fungus cultivation [M]. Beijing: Agricultural Press, 1988. (in Chinese)
[2] DENG YJ, ZHU J, XIE BG. Illustrated key to Volvariella volvacea cultivation technology[M]. Beijing: China Agricultural Press, 2011. (in Chinese)
[3] SUN XH. Cloning and analysis of cold induced gene from Volvariella volvacea[D]. Ph.D Thesis; Nanjing:Nanjing Agricultural University, 2006. (in Chinese with English abstract)
[4] LIU SQ, YANG LQ, GUO LQ, et al. Cloning and sequence analysis of ras promoter region from Volvariella volvacea [J]. Acta Edulis Fungi, 2004, 11(1):1-6. (in Chinese with English abstract)
[5] Meléndez R, Meléndez-Hevia E, Canela EI. The fractal structure of glycogen: a clever solution to optimize cell metabolism[J]. Biophys J, 1999, 77(3):1327-1332.
[6] François JM, Walther T, Parrou JL. Genetics and regulation of glycogen and trehalose metabolism in Saccharomyces cerevisiae[J]. Microbiol Monogr, 2012, 22:29-55.
[7] Bertolini MC, Freitas FZ, De Paula RM, et al. Glycogen metabolism regulation in Neurospora crassa[M]. Biocommunication of Fungi, 2012, 39-55.
[8] LI XF. Analysis of glucose in blood and enzyme specific activity of low temperature-stressed Rana dybowskii[D]. Master’s Thesis; Harbin: Northeast Forestry University, 2012. (in Chinese with English abstract)
[9] ZHAO N. Expression pattern of glycogen phosphorylase gene during development and in response to temperature stress from brine shrimp, Artemia sinica[D]. Master’s Thesis; Dalian:Liaoning Normal University, 2013. (in Chinese with English abstract)
[10] WANG P. Analysis of Volvariella volvacea expression profile and the key gene of related cold-stress metabolic pathways expression[D]. Master’s Thesis; Nanjing:Nanjing Agricultural University, 2012. (in Chinese with English abstract)
[11] WU GM. Correlational study on the metabolic pathway of S-adenosyl-L-homocysteine hydrolase and autolysis in Volvariella volvacea[D]. Master’s Thesis; Shanghai:Shanghai Ocean University, 2012. (in Chinese with English abstract)
[12] HAN YJ, CAO H, CHEN MJ, et al. Selection for cold-resistant strain by complex mutagenesis of Volvariella volvacea and identification of the strain[J]. Mycosystema, 2004, 23(3):417-422. (in Chinese with English abstract)
[13] WANG H, CHEN MJ. Construction of a plasmid and a standard curve for real-time quantitative PCR of the cold-induced Cor3gene from Volvariella volvacea[J]. Acta Edulis Fungi, 2007, 14(3):16-19.
[14] XU LH, LIU CL, CHANG YM, et al. Theory and method of double-standard curves method of relative quantification PCR[J]. Biotechnol Bull, 2011, (1):70-75. (in Chinese with English abstract)
[15] WANG JY, ZHU SG, XU CF. Biochemistry[M]. 3rd ed. Beijing:Higher Education Press, 2002.
[16] LIU PH, XIE BG, DENG YJ, et al. Cloning, structural analyses and expression levels of phosphofructokinase gene in different strains of Volvariella volvacea [J]. Mycosystema, 2013, 32(2):253-260. (in Chinese with English abstract)

Received: June 2,2014;Accepted:July 22,2014
Sponsored by National Natural Science Foundation of China (No. 31301828),the Shanghai Municipal
Government Foundation(No. 2011.1-2)
Corresponding author.  E-mail:mjchen@saas.sh.cn


The half-yearly WSMBMP Bulletin is the official electronic publication of the World Society for Mushroom Biology and Mushroom Products. The Bulletin is intended to keep members informed about Council activities and to share general information about mushrooms. It is designed to allow communication between society members and alert them to new topics and opportunities related to mushrooms. Society members and the general public are kindly invited to submit letters, comments and information of interest to the mushroom community for publication in the Bulletin. Please submit your contributions electronically in free format to Ms. Meilian Yu (saasyml@126.com).


back to the beginning